View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_high_15 (Length: 419)
Name: NF5404_high_15
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 12 - 397
Target Start/End: Complemental strand, 12315619 - 12315234
Alignment:
| Q |
12 |
taatatagggaaggtatatcttatagtactaaatgtatagagacattataatttattgtgttagtgggaattgttgcattgtgtatgttacttaggattt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12315619 |
taatatagggaaggtatatcttatagtactacatgtatagagacattataatttattgtgttagtgggaattgttgtattgtgtatgttacttaggattt |
12315520 |
T |
|
| Q |
112 |
cgtccctattgggggtattattagtcccgtattgtgtgatgatttataagatatagataagtctattttttgggacttatattgtaatagcttgattgga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12315519 |
cgtccctattgggggtattattagtcccgtattgtgtgatgatttataagatatagataagtctattttttgggacttatattgtaatagcttgattgga |
12315420 |
T |
|
| Q |
212 |
tttttatatatatcaggtttcaattatcaactcgtgtatcattgcaagcatgnnnnnnnggttgatttcattatgnnnnnnnggtagataagcatgttta |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
12315419 |
tttttatatatatcaggtttcaattatcaactcgtgtatcattgcaagcatgtttttttggttgatttgattatgtttttttggtagataagcatgttta |
12315320 |
T |
|
| Q |
312 |
atattaattcatgtttaaacatcttttaaatgctttttgagtttgaatatctttcctatcttggactatgacattatcccctcatc |
397 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12315319 |
atattaatttatgtttaaacatcttttaaatgctttttgagtccgaatatctttcctatcttggactatgacactatcccctcatc |
12315234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University