View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_high_22 (Length: 383)
Name: NF5404_high_22
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_high_22 |
 |  |
|
| [»] scaffold0771 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0771 (Bit Score: 126; Significance: 7e-65; HSPs: 1)
Name: scaffold0771
Description:
Target: scaffold0771; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 10 - 147
Target Start/End: Complemental strand, 1458 - 1321
Alignment:
| Q |
10 |
ataatactctatcataaaggtagatagaattgtagtttccaaactagtggaaagttattgctggatatgtggtcagtggcttcctaatatatctcgttct |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1458 |
ataatactctatcataaaggtagacagaattgtagtttccaaactagtgaaaagttattgctggatatgtggtcagtggcttcctaatatatctcgttct |
1359 |
T |
 |
| Q |
110 |
tcacttaccgcaacataataatcatatttataccaaca |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1358 |
tcacttaccgcaacataataatcatattcataccaaca |
1321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 126; Significance: 7e-65; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 10 - 147
Target Start/End: Complemental strand, 13949318 - 13949181
Alignment:
| Q |
10 |
ataatactctatcataaaggtagatagaattgtagtttccaaactagtggaaagttattgctggatatgtggtcagtggcttcctaatatatctcgttct |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13949318 |
ataatactctatcataaaggtagacagaattgtagtttccaaactagtgaaaagttattgctggatatgtggtcagtggcttcctaatatatctcgttct |
13949219 |
T |
 |
| Q |
110 |
tcacttaccgcaacataataatcatatttataccaaca |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13949218 |
tcacttaccgcaacataataatcatattcataccaaca |
13949181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 114 - 280
Target Start/End: Complemental strand, 20899429 - 20899267
Alignment:
| Q |
114 |
ttaccgcaacataataatcatatttataccaacatacagttatcataaaccaataaatgggaagtaaaaactcatgcatttcaagttacacattgttttg |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
20899429 |
ttaccgcaacataataatcatattcataccaacatatagttatcataaaccaaa----gggaagtaaaaactcatgcgtttcaagctacacattattttg |
20899334 |
T |
 |
| Q |
214 |
gcgtttgcattagttgaaaacatgacaaaaacacaagaatgttaattaaagaacatacttatggttc |
280 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
20899333 |
gcgttttcattaattgaaaacatgacaaaaacacaagaatgatatttaaagaacagtcttatggttc |
20899267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 45 - 91
Target Start/End: Complemental strand, 20899475 - 20899429
Alignment:
| Q |
45 |
tttccaaactagtggaaagttattgctggatatgtggtcagtggctt |
91 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
20899475 |
tttccaaacttgtgaaaagttattgctgaatatttggtcagtggctt |
20899429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University