View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_high_44 (Length: 247)
Name: NF5404_high_44
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_high_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 25954111 - 25953989
Alignment:
| Q |
19 |
tcttttaatttattgatgagatttattgattcaatgatggaaataaacatgtgtataatgtaagacttgtttcacttgtttactgtagaattggtcattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25954111 |
tcttttaatttattgatgagatttattgattcaatgatggaaataaacatatgcataatgtaagacttgtttcacttgtttactgtagaattggtcattt |
25954012 |
T |
|
| Q |
119 |
ccacggttgaatcaatagttata |
141 |
Q |
| |
|
||| ||||| ||||||||||||| |
|
|
| T |
25954011 |
ccatggttggatcaatagttata |
25953989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 25953935 - 25953881
Alignment:
| Q |
193 |
catatatcattacaaaagaaagaaaaaggtgatattgactaaggtatttgatatt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25953935 |
catatatcattacaaaagaaagaaaaaggtgatattgactaaggtatttgatatt |
25953881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 22 - 95
Target Start/End: Complemental strand, 6863112 - 6863039
Alignment:
| Q |
22 |
tttaatttattgatgagatttattgattcaatgatggaaataaacatgtgtataatgtaagacttgtttcactt |
95 |
Q |
| |
|
||||||||| || |||||||||||||| ||||| |||||| | | ||||||| ||| ||||||||| |||||| |
|
|
| T |
6863112 |
tttaatttaatggtgagatttattgatccaatggtggaaactagcttgtgtatgatgcaagacttgtctcactt |
6863039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University