View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_high_47 (Length: 242)
Name: NF5404_high_47
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 23 - 225
Target Start/End: Original strand, 37378402 - 37378601
Alignment:
| Q |
23 |
cacagatgtcttgaattttatttctgggaaataataaaaatataaatgtatgtattaatacacatgatcgatatttcattgagtgttgtaaccaactgtt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37378402 |
cacagatgtcttgaattttatttctgggaaataataagaatataaatgtatgtatta---cacatgatcgatatttcattgagtgttgtaaccaactgtt |
37378498 |
T |
 |
| Q |
123 |
agaaatttttgtgaagaaatcatttaaaataaacaagaatagtttacttaattcgatccaaattgacctattataggagagatccctccgctttactatc |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
37378499 |
agaaatttttgtgaaggaatcatttaaaataaacaagaatagtttacttaattcgatccaaattgacctattataagagagacctctccgctttactatc |
37378598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University