View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_high_48 (Length: 240)
Name: NF5404_high_48
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 63 - 222
Target Start/End: Original strand, 14083226 - 14083385
Alignment:
| Q |
63 |
tatgaaaatgaattcacatttatacccattgtatataatttagagcgttcatagacactttagaattacttgtgcaatcatattttattcttcgagttta |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14083226 |
tatgaaaatgaattcacatttatacccattgtatataatttagagtgttcatagacactttagaattacttgtgcaatcatattttattcttcgagttta |
14083325 |
T |
 |
| Q |
163 |
agttttgcaggatcccttaacacaagatctcacaaaatttatatcagttatgatggatat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
14083326 |
agttttgcaggatcccttaacacaagatctcacaaaatttatatcaggtaggatggatat |
14083385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 66
Target Start/End: Original strand, 14082762 - 14082814
Alignment:
| Q |
14 |
aaatgaatctaaaatgagtgtagagttcgcttcaaggtttctaaagtattatg |
66 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14082762 |
aaatgaatctaaaatgagtgtatagttcgcttcaaggtttctaaagtattatg |
14082814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University