View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_high_53 (Length: 233)
Name: NF5404_high_53
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 16511768 - 16511976
Alignment:
| Q |
1 |
aggaggagtgagtttgtttaaagccatcaaattttagaactttacttgttacattcaatttgaacagtttatctaatttgtannnnnnnncattatagat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||| ||| ||||||||||| |||||| ||||||||||||||||| |||||||||| |
|
|
| T |
16511768 |
aggaggagtgagtttgtttaaagccctcaaatttttgaactctacatgttacattcagtttgaagagtttatctaatttgtattttttttcattatagat |
16511867 |
T |
 |
| Q |
101 |
tttggcagatgcaatgggacttggaaagactgttatgacaattgcactgattcttagtaatccaggcaggttgaagtcagaagacagtgatggagagagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16511868 |
tttggcagatgcaatgggacttggaaagaccgttatgacaattgcactgattcttagtaatccaggcaggttgaagtcagaagacagtgatggagagagc |
16511967 |
T |
 |
| Q |
201 |
gtatatgac |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
16511968 |
gtatatgac |
16511976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University