View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_low_32 (Length: 280)
Name: NF5404_low_32
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_low_32 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 280
Target Start/End: Complemental strand, 15440020 - 15439753
Alignment:
| Q |
13 |
attcttttccacaatattttgaaacttttgatgttctttgcctttggacacttgagatagtaaggccgagacatgtcgagactgtatttcaaaactagat |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||| ||| ||||||| ||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15440020 |
attcttttccacaatattttgaaacttgtgatgttcattgcctttagactcttgagacagtgaggccgagacatgtcgagactgtatttcgaaactagat |
15439921 |
T |
 |
| Q |
113 |
ccttcaacaggaattggtgccattttaggtgaagccacacaccgtgatagttgttttaatccaggtctttggactagagatttgactgaacttgacttag |
212 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15439920 |
ccttcaacagggattggtgtcattttaggtgaagccacacaccctgatggttgttttaatccaggtttttggactagagatttgactgaacttgacttag |
15439821 |
T |
 |
| Q |
213 |
cattggcctcgggttttgatgattttaatccaggtctttcaactggcgatttgactgtacctgactta |
280 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||| | |||||||||| |||||||||| |
|
|
| T |
15439820 |
cattgacctcgggttttgatgattttaatccaggtctttggactagagatttgactgaacctgactta |
15439753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 166 - 237
Target Start/End: Complemental strand, 15439798 - 15439727
Alignment:
| Q |
166 |
ttttaatccaggtctttggactagagatttgactgaacttgacttagcattggcctcgggttttgatgattt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15439798 |
ttttaatccaggtctttggactagagatttgactgaacctgacttagcattggcctcgggttttgatgattt |
15439727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University