View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_low_39 (Length: 258)
Name: NF5404_low_39
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 248
Target Start/End: Original strand, 49127998 - 49128226
Alignment:
| Q |
20 |
tgttgtttgactaaacttggttgtaggaattacgttatagtgcacaatctccaaagcataatttattataagtatagtgaattaaaaataatagtcacat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49127998 |
tgttgtttgactaaacttggttgtaggaattacgttatagtgcacaatctccatagcataatttattataagtatagtgaattaaaaataatagtcacag |
49128097 |
T |
 |
| Q |
120 |
attttctttatnnnnnnngctttgaattttgaccatttcaaatttgtcttttgattttgaagtatggatgtgcacatattcacttaaaaatatttggtgt |
219 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49128098 |
attttctttataaaaaaagctttgaattttgaccatttcaaatttgtcttttgattttgaagtatggatgtgcacatattcacttaaaaatatttggtgt |
49128197 |
T |
 |
| Q |
220 |
gataagtttaatgatgtaaatgagaataa |
248 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
49128198 |
gataagtttaatgatgtaaatgaaaataa |
49128226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University