View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5404_low_50 (Length: 240)

Name: NF5404_low_50
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5404_low_50
NF5404_low_50
[»] chr5 (2 HSPs)
chr5 (63-222)||(14083226-14083385)
chr5 (14-66)||(14082762-14082814)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 63 - 222
Target Start/End: Original strand, 14083226 - 14083385
Alignment:
63 tatgaaaatgaattcacatttatacccattgtatataatttagagcgttcatagacactttagaattacttgtgcaatcatattttattcttcgagttta 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14083226 tatgaaaatgaattcacatttatacccattgtatataatttagagtgttcatagacactttagaattacttgtgcaatcatattttattcttcgagttta 14083325  T
163 agttttgcaggatcccttaacacaagatctcacaaaatttatatcagttatgatggatat 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||    
14083326 agttttgcaggatcccttaacacaagatctcacaaaatttatatcaggtaggatggatat 14083385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 66
Target Start/End: Original strand, 14082762 - 14082814
Alignment:
14 aaatgaatctaaaatgagtgtagagttcgcttcaaggtttctaaagtattatg 66  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||    
14082762 aaatgaatctaaaatgagtgtatagttcgcttcaaggtttctaaagtattatg 14082814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University