View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5404_low_57 (Length: 229)
Name: NF5404_low_57
Description: NF5404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5404_low_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 40826809 - 40827006
Alignment:
| Q |
18 |
ataaaaccatactcaataacacaaacaaatcacaatgacttgctaatattattaaatacaataatattataggatgaacaactaaatatannnnnnngtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
40826809 |
ataaaaccatactcaataacacaaacaaatcacaatgacttgctaatattattaaatactataatattataggatgaacaactaaatatttttttttgtg |
40826908 |
T |
|
| Q |
118 |
aaagaaactaaatacatatagtcatgctatagcatgaaaattatattactttatattcttgaagcgggcaacatcgatctctagtcttcctccctatg |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
40826909 |
aaagaaactaaatatatatagtcatgctatagcatgaaaattatattactttatattcttgaagcgggcaacatcgatctccagtcttcctcactatg |
40827006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University