View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5406_high_4 (Length: 256)
Name: NF5406_high_4
Description: NF5406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5406_high_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 256
Target Start/End: Complemental strand, 30619815 - 30619581
Alignment:
| Q |
19 |
caatgtacatggttttgcagtttacttgggtgagtgggatatgatttcctctatgaaatttttattttattcttttcaagagtgttaatttgttgatgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30619815 |
caatgtacatggttttgcagtttacttgggtgagtgggatatgatt----ctatgaaatttttattttattcttttcaagagtgtttatttgttgatgtt |
30619720 |
T |
|
| Q |
119 |
ggtttatatact-tttgtaggaggttatgacaaagaagaaaaggcagctagagcctatgatttggcagcactaaaatattggggaacaactactacaaca |
217 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30619719 |
ggtttatgtactatttgtaggaggttatgacaaagaagaaaaagcagctagagcctatgatttggcagcactaaaatattggggaacaactactacaaca |
30619620 |
T |
|
| Q |
218 |
aattttccagtgagttaatttccacttactcttttaatt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30619619 |
aattttccagtgagttaatttccacttactcttttaatt |
30619581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 130 - 201
Target Start/End: Complemental strand, 13682099 - 13682028
Alignment:
| Q |
130 |
ttttgtaggaggttatgacaaagaagaaaaggcagctagagcctatgatttggcagcactaaaatattgggg |
201 |
Q |
| |
|
||||||||| || |||||||||||||||||||| || ||| ||||||||||||| || ||||| |||||||| |
|
|
| T |
13682099 |
ttttgtaggtggatatgacaaagaagaaaaggccgcaagatcctatgatttggctgctctaaagtattgggg |
13682028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 143 - 225
Target Start/End: Complemental strand, 41964947 - 41964865
Alignment:
| Q |
143 |
tatgacaaagaagaaaaggcagctagagcctatgatttggcagcactaaaatattggggaacaactactacaacaaattttcc |
225 |
Q |
| |
|
|||||||||||||| || |||||||| || |||||||| |||||||||||||| ||||| ||| |||| || ||||| ||||| |
|
|
| T |
41964947 |
tatgacaaagaagagaaagcagctagggcttatgatttagcagcactaaaatactgggggacatctaccactacaaactttcc |
41964865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 143 - 207
Target Start/End: Complemental strand, 28588185 - 28588121
Alignment:
| Q |
143 |
tatgacaaagaagaaaaggcagctagagcctatgatttggcagcactaaaatattggggaacaac |
207 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||||||||||| || || |||||| |||| |
|
|
| T |
28588185 |
tatgacaaggaagaaaaggcagctagggcttatgatttggcagcactgaagtactggggaccaac |
28588121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University