View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5406_low_6 (Length: 239)
Name: NF5406_low_6
Description: NF5406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5406_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 4265868 - 4266078
Alignment:
| Q |
11 |
aataatatatatatcccaccgtataccacgttttaggtgcgtcatttgagtgaaggttcatgacgtatatcactaacgagagtcccacaataattattaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4265868 |
aataatatatatatcccaccgtataccacgttttaggtgcgtcatttgagtgaaggttcatgacgtatatcactaacgagagtaccacaataattattaa |
4265967 |
T |
 |
| Q |
111 |
aacatgctcgacgtacacatactagtttattataagattgttacttgttttgaatttagttcatatataagtggttttcttctacattcaatcgtatatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4265968 |
aacatgctcgacgtacacatactagtttattataagattgttacttgttttgaatttagttcgtatataagtggttttcttctacattcaatcgtatatc |
4266067 |
T |
 |
| Q |
211 |
attatgtatga |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
4266068 |
attatgtatga |
4266078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University