View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5407-Insertion-1 (Length: 158)
Name: NF5407-Insertion-1
Description: NF5407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5407-Insertion-1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 3e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 8 - 71
Target Start/End: Original strand, 17467826 - 17467889
Alignment:
| Q |
8 |
attacatcatttatacatggataattggtaatagatagatgaatatggaaaatagtatcatata |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17467826 |
attacatcatttatacatggataattggtaatagatagatgaatatggaaaatagtatcatata |
17467889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 76 - 124
Target Start/End: Original strand, 17468189 - 17468237
Alignment:
| Q |
76 |
ttttagattcttttatgaaacaaattgtttgattagatgaacatatata |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17468189 |
ttttagattcttttatgaaacaaattgtttgattagatgaacatatata |
17468237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University