View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5407_high_4 (Length: 269)
Name: NF5407_high_4
Description: NF5407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5407_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 74 - 259
Target Start/End: Complemental strand, 43576514 - 43576338
Alignment:
| Q |
74 |
gtttaatttgaagggtgtatgtacagtggtagccggaggtgaatgaaggaagaataatactaccagctccacccacaaacacaaacacaaacacaagttg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43576514 |
gtttaatttgaagggtgtatgtacagtggtagccggaggtgaatgaaggaagaataatactaccagctccacccacaaacacaaacacaa---------- |
43576425 |
T |
|
| Q |
174 |
tttgtttggtgcgaagatg-nnnnnnngttttgtgggctaagggaggtgaacggacaaaaactgagggatttgtactttacactact |
259 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
43576424 |
gttgtttggtgcgaagatgttttttttgttttgtgggctaagggaggtgaacagacaaaaactgagggatttttactttacactact |
43576338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University