View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5407_high_4 (Length: 269)

Name: NF5407_high_4
Description: NF5407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5407_high_4
NF5407_high_4
[»] chr3 (1 HSPs)
chr3 (74-259)||(43576338-43576514)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 74 - 259
Target Start/End: Complemental strand, 43576514 - 43576338
Alignment:
74 gtttaatttgaagggtgtatgtacagtggtagccggaggtgaatgaaggaagaataatactaccagctccacccacaaacacaaacacaaacacaagttg 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||              
43576514 gtttaatttgaagggtgtatgtacagtggtagccggaggtgaatgaaggaagaataatactaccagctccacccacaaacacaaacacaa---------- 43576425  T
174 tttgtttggtgcgaagatg-nnnnnnngttttgtgggctaagggaggtgaacggacaaaaactgagggatttgtactttacactact 259  Q
     ||||||||||||||||||        ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||    
43576424 gttgtttggtgcgaagatgttttttttgttttgtgggctaagggaggtgaacagacaaaaactgagggatttttactttacactact 43576338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University