View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5407_low_7 (Length: 229)
Name: NF5407_low_7
Description: NF5407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5407_low_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 37971963 - 37972191
Alignment:
| Q |
1 |
tattactgaaaggtcaactctgaacaacaattaacaacggagcacttagttttcctcaaattcattcaaatgaaactacaatttctaaatatttagaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37971963 |
tattactgaaaggtcaactctgaacaataattaacaacggagcacttagttttcctcaaattcattcaaatgaaactacaatttctaaatatttagaaca |
37972062 |
T |
 |
| Q |
101 |
agagatatcaattattaccgaagtgggatcaagatgattagtacaaacgcgtggaagatttttctgcgctccctgcaatgagtgcnnnnnnntatttatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
37972063 |
agagatatcaattattaccgaagtgggatcaagatgattagtacaaacgcgtggaagattcttctgcgctccctgcaatgagtgcaaaaaaatatttatc |
37972162 |
T |
 |
| Q |
201 |
atcaatcatcatgctttatataaggttat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37972163 |
atcaatcatcatgctttatataaggttat |
37972191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University