View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5408-Insertion-5 (Length: 382)
Name: NF5408-Insertion-5
Description: NF5408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5408-Insertion-5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 7e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 54 - 382
Target Start/End: Complemental strand, 33170116 - 33169786
Alignment:
| Q |
54 |
gatttcatgattatatcttacgcaaaactatataaattggaaaatgcaacactagaaacttcaagnnnnnnnnnttacttcaatggtgtattggtcacaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33170116 |
gatttcatgattatatcttacgcaaaactatataaattggaaaatgcaacactagaaacttcaaggaaaaaaaaatacttcaatggtgtattggtcacaa |
33170017 |
T |
|
| Q |
154 |
ataaccgattctcactgtcacgaccctattttgatacctctac-atcattctcggaatggtttgttataactatatgtcgattttctctaactgacctag |
252 |
Q |
| |
|
||||||||||||| || ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| || ||| |
|
|
| T |
33170016 |
ataaccgattctcgctatcacggccttattttgatacctctaccatcattctcggaatggtttgttataactatatgtagattttctctaaccgaactac |
33169917 |
T |
|
| Q |
253 |
aacacctcttttgttttaaataacctctttttattataaaattcattatgacaaccgtcttcttccgatcatctaacaactttgactatnnnnnnnggtt |
352 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || | ||||||||||||| | | || ||||||||||||||||||||||||||||| ||| |
|
|
| T |
33169916 |
aacacctcttttgttttaaataacccatttttgttgtgaaattcattatgagagtcatcatcttccgatcatctaacaactttgactataagaaaaagtt |
33169817 |
T |
|
| Q |
353 |
atgcat-ccatttcaaggttgattgtttgga |
382 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| |
|
|
| T |
33169816 |
atgcatcccattttaaggttgattgtttgga |
33169786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University