View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5408_high_10 (Length: 240)
Name: NF5408_high_10
Description: NF5408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5408_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 25 - 222
Target Start/End: Complemental strand, 21292308 - 21292111
Alignment:
| Q |
25 |
tttttgggtttctgttattagtttcattggtaaactttagatgctatgtatttgtgttcattcttcagtttatctgccgctctaacttgtctcctatatg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21292308 |
tttttgggtttctgttattagtttcattggtaaactttagatgctatgtattagtgttcattcttcagtttatctcccgctctaacttgtctcctatatg |
21292209 |
T |
 |
| Q |
125 |
atattgttaacttgttcttcgttcgtttctttttgttgcgttcatgtaaaaacatattggtctaatcttgatcttaattgttacatagttatttataa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21292208 |
atattgttaacttgttcttcgttcgtttctttttgttgcgttcatctaaaaacatattggtctaatcttgatcttaattgttacatagttatttataa |
21292111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University