View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5408_low_6 (Length: 310)
Name: NF5408_low_6
Description: NF5408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5408_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 126 - 250
Target Start/End: Original strand, 21292611 - 21292735
Alignment:
| Q |
126 |
atagaggaaaaaagaacataaaaaatcaaatgatacaataaatttgttctcaatcgtttgccgcagttgcatttgctttttgtcggtggaagctttgtaa |
225 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
21292611 |
atagaggaaaaaagagcatcaaaaatcaaatgatacaataaatttgttctctatggtttgccgcagttgtatttgctttttgtcggcggaagctttgtaa |
21292710 |
T |
 |
| Q |
226 |
gcttgccgtgttcttttcagtgata |
250 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
21292711 |
gcttgccgcgttcttttcagtgata |
21292735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 21292527 - 21292613
Alignment:
| Q |
1 |
ttatactatctcataatgtataaaaacttattttcacattgtttcttaaagtttcatacggtaattattttaaaaattgttttcata |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
21292527 |
ttatactatctcataatgtataaaaacttattttcacattgtttcttaaagtttcacaaggtaattattttaaaaattgttttcata |
21292613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University