View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5409_high_8 (Length: 245)

Name: NF5409_high_8
Description: NF5409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5409_high_8
NF5409_high_8
[»] chr2 (1 HSPs)
chr2 (22-204)||(19496160-19496342)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 22 - 204
Target Start/End: Original strand, 19496160 - 19496342
Alignment:
22 atagtttcgatacaaagcagattcaagatggctggtgaacccaacacgagtatcatggcctcgaaagttgataaatacatcatattttttatgaggcact 121  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19496160 atagtttcgacacaaagcagattcaagatggctggtgaacccaacacgagtatcatggcctcgaaagttgataaatacatcatattttttatgaggcact 19496259  T
122 gtagcagcaacagggcgagaggaagaagttgccataaccgtagccatgtgtgttttctggttcttagatataaaatgcgggat 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
19496260 gtagcagcaacagggcgagaggaagaagttgccataaccgtagccatttgtgttttctggttcttagatataaaatgcgggat 19496342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University