View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5410_low_19 (Length: 229)
Name: NF5410_low_19
Description: NF5410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5410_low_19 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 229
Target Start/End: Complemental strand, 29878763 - 29878538
Alignment:
| Q |
8 |
ctagctatttccttcatttcagctgcatgatattcatttcgatctatgtgtttttatttgctcacta---cttaatttcatgccttaccaacattatata |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29878763 |
ctagctatttccttcatttcagctgcatgctattcatttcgatctatgtgtttttatttgctcactagtacttaatttcatgccttaccaacattatata |
29878664 |
T |
|
| Q |
105 |
tagcaattattgacaccaaataatgattttgacatttacaaaaaataaat-aaagatttaaagggtccagctacaactcttatcataataataatcaatc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29878663 |
tagcaattattgacaccaaataatgattttgacatttacaaaaaataaataaaagatttaaagggtccagctacaactcttatcataataataatcaatc |
29878564 |
T |
|
| Q |
204 |
caaaaaagtcaaacatatgtgtacct |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29878563 |
caaaaaagtcaaacatatgtgtacct |
29878538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University