View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5410_low_20 (Length: 217)
Name: NF5410_low_20
Description: NF5410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5410_low_20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 32065644 - 32065842
Alignment:
| Q |
19 |
aattctttcggaatgagtgtgagaatgagataaagatcattaactgagaatctgttaaaaggaggtttcttcatcttatctgagctttcatcaccaacag |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32065644 |
aattctttcggaatgagtttgagaatgagataaagatcattaactgagaatctgttaaaaggaggtttcttcatcttatctgagctttcatcaccaacag |
32065743 |
T |
|
| Q |
119 |
tgagaatggtgacagagtgtccagcaccaagtagctcttttgcaaagtagaagccaatcacagcatgtccaccactattggtatttatgattagcacct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32065744 |
tgagaatggtgacagagtgtccagcaccaagtagctcttttgcaaagtagaagccaatcacagcatgtccaccactattggtatttatgattagcacct |
32065842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University