View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5410_low_21 (Length: 210)

Name: NF5410_low_21
Description: NF5410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5410_low_21
NF5410_low_21
[»] chr8 (1 HSPs)
chr8 (52-188)||(31594150-31594286)


Alignment Details
Target: chr8 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 52 - 188
Target Start/End: Complemental strand, 31594286 - 31594150
Alignment:
52 aactatacacttgctagcaaaattgatatagttgctacaaattatgaatcacatacgagatgacccctgaaataagcttgaatcttaattgctgcaaagt 151  Q
    ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
31594286 aactatatacttgctagcaatattgatatagttgctacaaattatgaatcacatactagatgacccctgaaataagcttgaatcttaattgctgcaaagt 31594187  T
152 cttctttggtgaatatggtcgatgaagaattaatagc 188  Q
    |||||||||||||||||||| ||||||||||||||||    
31594186 cttctttggtgaatatggtcaatgaagaattaatagc 31594150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University