View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5410_low_21 (Length: 210)
Name: NF5410_low_21
Description: NF5410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5410_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 52 - 188
Target Start/End: Complemental strand, 31594286 - 31594150
Alignment:
| Q |
52 |
aactatacacttgctagcaaaattgatatagttgctacaaattatgaatcacatacgagatgacccctgaaataagcttgaatcttaattgctgcaaagt |
151 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31594286 |
aactatatacttgctagcaatattgatatagttgctacaaattatgaatcacatactagatgacccctgaaataagcttgaatcttaattgctgcaaagt |
31594187 |
T |
|
| Q |
152 |
cttctttggtgaatatggtcgatgaagaattaatagc |
188 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31594186 |
cttctttggtgaatatggtcaatgaagaattaatagc |
31594150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University