View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5412-Insertion-4 (Length: 464)
Name: NF5412-Insertion-4
Description: NF5412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5412-Insertion-4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 4e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 7 - 106
Target Start/End: Complemental strand, 4638689 - 4638590
Alignment:
| Q |
7 |
acttcatttagttcattccctcccactacctcattcatgtctttcatcacttgagtccggtacccttttctttctccacaacaggttctggtccggttcc |
106 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4638689 |
acttcatttcgttcattccctcccactacctcattcatgtctttcatcacttgagtccggttcccttttctttctccacaacaggttctggtctggttcc |
4638590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 170 - 232
Target Start/End: Complemental strand, 4638518 - 4638456
Alignment:
| Q |
170 |
ctaaggttgtaattcatcttcttcctctggttcgtttgccattaattttcaaggtcagggttc |
232 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4638518 |
ctaaggttgtaattcatcttcttcctcaggttcgtttgccattaattttcaaggtcagggttc |
4638456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University