View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5412_high_1 (Length: 367)
Name: NF5412_high_1
Description: NF5412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5412_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 6e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 44096634 - 44096809
Alignment:
| Q |
17 |
ataaggcaattacagatagggttgttggtgtgcagtgtacttgatcataaacatgtatacatttggtatactactatgacaccacgtgtcccccaagggg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44096634 |
ataaggcaattacagatagggttgttggtgtgcagtgtacttgatcataaacatgtatacatttggtatactactatgacaccacgtgtcccccaagggg |
44096733 |
T |
|
| Q |
117 |
tctgctcttatcaaaatttttattgaggcagatatcaaactgttttcgttttttggtggaagatatcaaactgttt |
192 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44096734 |
tctgctcttatcaaaaaatttattgaggcagatatcaaactgttttcgttttttggtggaagatatcaaactgttt |
44096809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 234 - 358
Target Start/End: Original strand, 44096851 - 44096975
Alignment:
| Q |
234 |
tgcaaacgtgtctagcaattgtccacaatttcctacacatatatctactaaatttaattaccctcttagtatttatattcttgtttaatttgttttgctt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44096851 |
tgcaaacgtgtctagcaattgtccacaatttccttcacatatatctactaaatttaattaccctcttagtatttatattcttgtttaatttgttttgctt |
44096950 |
T |
|
| Q |
334 |
ctgggtcattcgtttaattgatgat |
358 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44096951 |
ctgggtcattcgtttaattgatgat |
44096975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University