View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413-Insertion-17 (Length: 177)
Name: NF5413-Insertion-17
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413-Insertion-17 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 9e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 9e-78
Query Start/End: Original strand, 8 - 177
Target Start/End: Complemental strand, 5807144 - 5806974
Alignment:
| Q |
8 |
tgatgtccactgaacactctctcctttcatgggtgtttaagagtaggtactttccgagaacaagttttttgaaggcacgtagtggctatcagcctagtta |
107 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5807144 |
tgatgtccaatgaacactctctcctttcatgggtgtttaagagtaggtactttccgagaacaagttttttgaaggcacgtagtggttatcagcctagtta |
5807045 |
T |
|
| Q |
108 |
tgcttggagaagtttgtgtaatgcaaaatcaataatcgatcttggttt-caggtggtcaattggaaacggg |
177 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
5807044 |
tgcttggagaagcttgtgtaatgcaaaatcaataattgatcttggtttgcaggtggtcaattggaaacggg |
5806974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 28; Significance: 0.0000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 46033753 - 46033812
Alignment:
| Q |
19 |
gaacactctctcctttcatgggtgtttaagagtaggtactttccgagaacaagttttttg |
78 |
Q |
| |
|
|||||||| |||||||| ||||||| ||||||||||||||| | ||| || |||||||| |
|
|
| T |
46033753 |
gaacactccctcctttctcgggtgttcaagagtaggtactttgccagatcatgttttttg |
46033812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University