View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_high_20 (Length: 396)
Name: NF5413_high_20
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_high_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 43 - 380
Target Start/End: Complemental strand, 13204661 - 13204324
Alignment:
| Q |
43 |
cctaatcacattttgattcatttcgtttcaatcccagcaataaaaccgttaattcccctcatttcgaaacccacataatttttaccaccgtttttcacag |
142 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
13204661 |
cctaatcacaatttgattcatttcatttcaatcccagcaacaaaaccgttaattcccctcatttcgaaacccacataatttttacaaccgcttttcacag |
13204562 |
T |
|
| Q |
143 |
aacgatccttagatttaccaacagttttttgtgcagattccttagattttttactaacttcaccatcagatttgccaacaaccttggacttttggttaga |
242 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
13204561 |
aacgatccttagatttaccaccagttttttgtgcagattccttagattttttactaccttcaccgtcagatttgccagcaaccttggacttttggttaga |
13204462 |
T |
|
| Q |
243 |
ctttgtagatggagcctttgatttacttgatgctgatccagatgtggaagaaggaagtcatggagcaagccttgaaccttctgctgatatgccgctaaaa |
342 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13204461 |
ctttgcagatggagcctttgatttacttgatgctgatccagatgtggaagaaggaagtcatggagcaagccttgaaccttctgctgatatgccgctaaaa |
13204362 |
T |
|
| Q |
343 |
aagaaagggaaaacaaatgctggtgaataaaataaagg |
380 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13204361 |
aagaaagagaaaacaaatgctggtgaataaaataaagg |
13204324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 123 - 274
Target Start/End: Complemental strand, 3038424 - 3038273
Alignment:
| Q |
123 |
tttaccaccgtttttcacagaacgatccttagatttaccaacagttttttgtgcagattccttagattttttactaacttcaccatcagatttgccaaca |
222 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||| |||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||| || |
|
|
| T |
3038424 |
tttaccaccacttttcacagaacgatcctcagatttaccaccagttttttgtgcagaatccttggattttttagtaacttcaccatcagatttgccagca |
3038325 |
T |
|
| Q |
223 |
accttggacttttggttagactttgtagatggagcctttgatttacttgatg |
274 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| | |||||||||||| |||| |
|
|
| T |
3038324 |
accttggacttttggttggactttgcagatggtgtctttgatttactggatg |
3038273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 288 - 333
Target Start/End: Original strand, 3037589 - 3037634
Alignment:
| Q |
288 |
ggaagaaggaagtcatggagcaagccttgaaccttctgctgatatg |
333 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
3037589 |
ggaagaaggaagtcatcgagcaagccctgaaccttctgcggatatg |
3037634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 333 - 370
Target Start/End: Original strand, 3038117 - 3038154
Alignment:
| Q |
333 |
gccgctaaaaaagaaagggaaaacaaatgctggtgaat |
370 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3038117 |
gccgctgaaaaagaaagggaaaacaaatgctggtgaat |
3038154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University