View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_high_69 (Length: 239)
Name: NF5413_high_69
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_high_69 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 239
Target Start/End: Complemental strand, 19641485 - 19641260
Alignment:
| Q |
14 |
atatgttgtataaattttttattgtttaaaaaagtttaaacatttactagtatccatccttatagtatagcatacatttttgataagagagaactatgaa |
113 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19641485 |
atatgttgcataaattttttattgtttaaaaaaatttaaacatttactagtatccatccttatagtatagcatacatttttgataagagagaactatgaa |
19641386 |
T |
 |
| Q |
114 |
attcatatttataaaatttatggatttcaggtacgatttatcataatgggcaaccttttttgttctgagtataccatacatagacgctttgatttgaagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19641385 |
attcatatttataaaatttatggatttcaggtacgatttatcataatgggcaaccttttttgttctgagtataccatacatagacgctttgatttgaagg |
19641286 |
T |
 |
| Q |
214 |
gttcttcacttgggcgcataacgact |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
19641285 |
gttcttcacttgggcgcataacgact |
19641260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 138 - 231
Target Start/End: Original strand, 35258630 - 35258723
Alignment:
| Q |
138 |
tttcaggtacgatttatcataatgggcaaccttttttgttctgagtataccatacatagacgctttgatttgaagggttcttcacttgggcgca |
231 |
Q |
| |
|
|||||||| |||||||||||||||| ||||| |||||||||||||||| || |||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
35258630 |
tttcaggttagatttatcataatgggaaacctcttttgttctgagtatatcacgcatagacgctatgatttgaagggttcttcacttggtcgca |
35258723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University