View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_high_72 (Length: 238)
Name: NF5413_high_72
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_high_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 52296832 - 52297055
Alignment:
| Q |
1 |
atatagagtaaaaagttgctagtaaattcagttgtttgtgatttgttttaactgttggcttgttaactattatcaggggttggatccaaggtgtatagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296832 |
atatagagtaaaaagttgctagtaaattcagttgtttgtgatttgttttaactgttggcttgttaactattatcaggggttggatccaaggtgtatagct |
52296931 |
T |
 |
| Q |
101 |
aacttgttcctagatgctgaatgtgtaggggagaacgaaattaacaatgatttgtgtttcatactaaaattacaaacagaacaacacatcctccaagcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296932 |
aacttgttcctagatgctgaatgtgtaggggagaacgaaattaacaatgatttgtgtttcatactaaaattacaaacagaacaacacatcctccaagcac |
52297031 |
T |
 |
| Q |
201 |
aaagtacctccaatactgaaattg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52297032 |
aaagtacctccaatactgaaattg |
52297055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 135
Target Start/End: Original strand, 6827207 - 6827274
Alignment:
| Q |
68 |
tattatcaggggttggatccaaggtgtatagctaacttgttcctagatgctgaatgtgtaggggagaa |
135 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| |||||||| |||| || | ||||||||| ||||| |
|
|
| T |
6827207 |
tattatcaggggctggatccaaggtgtacagccaacttgtttttagacgcagtatgtgtaggagagaa |
6827274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University