View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_high_77 (Length: 228)
Name: NF5413_high_77
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_high_77 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 118 - 207
Target Start/End: Complemental strand, 3068613 - 3068524
Alignment:
| Q |
118 |
ctttccttattgttaatcttggtgaataatcaaatgaatttcattaaaccaaaaagagttttggacacataaccctaaattggccagctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3068613 |
ctttccttattgttaatcttggtgaataatcaaatgaatttcattaaaccaaaaagagtattggacacataaccctaaattggccagctt |
3068524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University