View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_30 (Length: 330)
Name: NF5413_low_30
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 10 - 312
Target Start/End: Complemental strand, 10557286 - 10556984
Alignment:
| Q |
10 |
gcacagatccaatctccttctcttatgtatctagttgctggatcaaaacctggtagagctccttcattgtaccttctctttgcttcttttctacactcta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557286 |
gcacagatccaatctccttctcttatgtatctagttgctggatcaaaacctggtagagctccttcattgtaccttctctttgcttcttttctacactcta |
10557187 |
T |
 |
| Q |
110 |
gtgcatactttatatggtttctgaactcacgttgcaaatcagcaacaaatttcaaagcatctttggttagaatttttgcaaactctgcatcatatcttcc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557186 |
gtgcatactttatatggtttctgaactcacgttgcaaatcagcaacaaatttcaaagcatctttggttagaatttttgcaaactctgcatcatatcttcc |
10557087 |
T |
 |
| Q |
210 |
cctaacttcgacaccttctggtgcgtcgtagttagagatgatattcttggctgttggtgtcggaaagccataggttccgaggtccatttttgcaatagca |
309 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10557086 |
cctaacttcgacgccttctggtgcatcgtagttagagatgatattcttggctgttggtgtcggaaagccataggttccgaggtccatttttgcaatagca |
10556987 |
T |
 |
| Q |
310 |
ctg |
312 |
Q |
| |
|
||| |
|
|
| T |
10556986 |
ctg |
10556984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University