View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_34 (Length: 316)
Name: NF5413_low_34
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 58 - 309
Target Start/End: Original strand, 35802113 - 35802364
Alignment:
| Q |
58 |
ttaatcaatccaaaataaaggtaagagagaagttcacttattgatattggtagcataaaagttatttgcaagtacgtctgccatatttagtagcacttaa |
157 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35802113 |
ttaatcaatccaaactaaaggtaagagagaagttcacttattgatattggtagcataaaagttatttgcaagtacgtctgcaatatttagtagcacttaa |
35802212 |
T |
 |
| Q |
158 |
actgaatttttaccttttgaattcttatctactttctagttcaaaacttgcaataagccatttgagattatggcctgcattttgcagagcaaagaaaatc |
257 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35802213 |
actgaacttttaccctttgaattcttatctactttctagtttaaaacttgcaataagccatttgagattatggcctgcattttgcagagcaaagaaaatc |
35802312 |
T |
 |
| Q |
258 |
aaaacacccataaaagcagtcgctgcatcgggcgccacagatagtaaaacat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35802313 |
aaaacacccataaaagcagtcgctgcatcgggcgctacagatagtaaaacat |
35802364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 35801993 - 35802051
Alignment:
| Q |
1 |
taatggaatggttaagagtaaagttcatatttccaaaccaaaatagtagcagtccattt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35801993 |
taatggaatggttaagagtaaagttcatatttccaaaccaaaatagtagcagtccattt |
35802051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 215 - 274
Target Start/End: Complemental strand, 56047022 - 56046963
Alignment:
| Q |
215 |
ccatttgagattatggcctgcattttgcagagcaaagaaaatcaaaacacccataaaagc |
274 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56047022 |
ccatttgagagtatggcctgcattttgcagagcaaagaaaatcaaaacacccataaaagc |
56046963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University