View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_42 (Length: 281)
Name: NF5413_low_42
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 52296646 - 52296381
Alignment:
| Q |
1 |
actttgccattactaccagcagttattttaaaaccagagactaccaattccaagcaccataaatctggagtgttttgccatagcacgaaacctcctactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52296646 |
actttgccattactaccagcagttattttaaaaccagagactaccaattccaagcaccataaatctggattgttttgccatagcacgaaacctcctactt |
52296547 |
T |
 |
| Q |
101 |
cagctttgcctcttgaatgaacgctgttatcatcggcaccatgacgcatctctgaaccatgtattctaacttctcccattgcatacatgttttgcaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296546 |
cagctttgcctcttgaatgaacgctgttatcatcggcaccatgacgcatctctgaaccatgtattctaacttctcccattgcatacatgttttgcaatga |
52296447 |
T |
 |
| Q |
201 |
attcaatgcaccttgtccaccggttgctgccacatattgttgcactatgtatttcccaattgaatc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296446 |
attcaatgcaccttgtccaccggttgctgccacatattgttgcactatgtatttcccaattgaatc |
52296381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University