View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_52 (Length: 256)
Name: NF5413_low_52
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 27617563 - 27617765
Alignment:
| Q |
20 |
gagtataggtttatcaagtatcctgaaatgagcgagcattcatctcatggtttgggcgagtatgggtccaatgtttttggtcctttgttgtagtctccaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27617563 |
gagtataggtttatcaagtatcctgaaatgagcgagcattcatctcatggtttgggcgagtatgggtccaatgtttttggtcctttgttgtagtctccaa |
27617662 |
T |
 |
| Q |
120 |
gtgt---tattattttatagataaa-tgttagcggttattttgtttaatggatgagaaaattgttaccacaagagattaaattttgatctttgtagcttc |
215 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27617663 |
gtgttagtattattttatagataaattgttagcggttattttgtttaatggatgagaaaattgttaccacaagagattaaactttgatctttgtagcttc |
27617762 |
T |
 |
| Q |
216 |
cga |
218 |
Q |
| |
|
||| |
|
|
| T |
27617763 |
cga |
27617765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University