View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_60 (Length: 248)
Name: NF5413_low_60
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 720274 - 720047
Alignment:
| Q |
8 |
catcatcaatgggaaacatgtttgggtcagaaaatattttagcaagccaccaccaccaccgtatgaagctgggacatcttggtattttccatgatgcatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
720274 |
catcatcaatgggaaacatgtttgggtcagaaaatattttagcaagccaccaccaccaccgtatgaagctgggacatcttggtattttccatgatgcatg |
720175 |
T |
 |
| Q |
108 |
ttttcttaaactttggttttgttgctttagatgaagctgggacat-ttggtgtttttcatgatgcaagttttcttaaacttaagttttgtttcttagaag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
720174 |
ttttcttaaactttggttttgttgctttagatgaagctgggacatcttggtgtttttcatgatgcaagttttcttaaacttaaattttgtttcttagaag |
720075 |
T |
 |
| Q |
207 |
attgatgaatttttcatgtcatcaaact |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
720074 |
attgatgaatttttcatgtcatcaaact |
720047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University