View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_61 (Length: 247)
Name: NF5413_low_61
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_61 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 12020163 - 12020396
Alignment:
| Q |
18 |
acatagacacaaaagcagtcaggtacgtacgaggttcttgtgtggatacataatcactaagtgaacaaacacaacaaaaccggtgagatac----aatac |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12020163 |
acatggacacaaaagcagtcaggtacgtacgaggttcttgtgtggatatataatcaccaagtgaacaaacacaacaaaaccggtgagatacatacaatac |
12020262 |
T |
 |
| Q |
114 |
aaggttccttgctttttctgagtaatacaaattaattaactaaaactggtaccaaatttaaagactaatcagaaccaatggtaaggaattgaagtggcta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12020263 |
aaggttccttgctttttctgagtaatacaaattaattaactaaaactggtaccaaatttaaagactaatcagaaccaatggtaaggaattgaagtggcta |
12020362 |
T |
 |
| Q |
214 |
acatgtcagcagaatgcaaatgcgccacgtgtct |
247 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
12020363 |
acatgtcagtagaatgcaaatgcgccacgtgtct |
12020396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University