View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_62 (Length: 246)
Name: NF5413_low_62
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_62 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 27162121 - 27161893
Alignment:
| Q |
18 |
gttaggttgttgctgttgtggtggaaacattgagaaagtgaagttgaaagaggaaatttgtgaagaaaataatttggcttccatttgtagggataccctt |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27162121 |
gttaggttgttgctgctgtggtggaaacattgagaaagtgaagttgaaagaggaaatttgtgaagaaaataatttggcttccatttgtagggataccctt |
27162022 |
T |
 |
| Q |
118 |
tttcatcatccagttaaaaccaagacttgtgaagctcttgccaagcttccttttacaatgtctctttattctaggtcttactctttctctctttaattgt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27162021 |
tttcatcatcgagttaaaaccaagacttgtgaagctcttgccaagcttccttttacaatgtctctttattctaggtcttactctttctctctttaattgt |
27161922 |
T |
 |
| Q |
218 |
ttgcattgcattgaatatcaattttctat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27161921 |
ttgcattgcattgaatatcaattttctat |
27161893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University