View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_77 (Length: 229)
Name: NF5413_low_77
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 35308407 - 35308227
Alignment:
| Q |
1 |
gaatgaagctgccaaccaagcttaaccctcgataagaaaaactaactcactaccgcaaaattaatcgagtcgggtca---aacattgttgttgtaggcca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35308407 |
gaatgaagctgccaaccaagcttaaccctcgataagaaaaactaactcactaccgcaaaattaatcgagtggggtcagacgacattgttgttgtaggcca |
35308308 |
T |
 |
| Q |
98 |
ctttattttgtccaatacgaatatattcacttataaataataactattctatatattgtnnnnnnntccaattaaatacaaaac |
181 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| ||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
35308307 |
ctttattttgtccaataccaatatatttgcttata---aataactattctatacattgtgaaaaaatccaattaaatacaaaac |
35308227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University