View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5413_low_79 (Length: 228)

Name: NF5413_low_79
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5413_low_79
NF5413_low_79
[»] chr6 (1 HSPs)
chr6 (118-207)||(3068524-3068613)


Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 118 - 207
Target Start/End: Complemental strand, 3068613 - 3068524
Alignment:
118 ctttccttattgttaatcttggtgaataatcaaatgaatttcattaaaccaaaaagagttttggacacataaccctaaattggccagctt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
3068613 ctttccttattgttaatcttggtgaataatcaaatgaatttcattaaaccaaaaagagtattggacacataaccctaaattggccagctt 3068524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University