View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5413_low_80 (Length: 224)
Name: NF5413_low_80
Description: NF5413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5413_low_80 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 53 - 213
Target Start/End: Original strand, 48682305 - 48682457
Alignment:
| Q |
53 |
aagaagaagaagaataaaaccctgcaaaaaccctttactctgttatccgaaacaaaaagaaacagagaggtacaagttgcttgttaccaaagag--atgt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
48682305 |
aagaagaagaagaataaaaccctgcaaaaaccctttactctgttatccgaaaca----------gagaggtacaagttgcttgttaccaaagagagatgt |
48682394 |
T |
 |
| Q |
151 |
tggatggatatcattttactgctttgttacttttcatttccatctttccttcttcatctcact |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48682395 |
tggatggatatcattttactgcttagttacttttcatttccatctttccttcttcatcacact |
48682457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 48682255 - 48682303
Alignment:
| Q |
18 |
caaagaacccatattgtttgtttaagaaagatgataagaagaagaagaa |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48682255 |
caaagaacccatattgtttgtttaagaaagatgataagaagaagaagaa |
48682303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University