View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5416_high_1 (Length: 413)
Name: NF5416_high_1
Description: NF5416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5416_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 1 - 397
Target Start/End: Original strand, 32135776 - 32136172
Alignment:
| Q |
1 |
aaccggagaatcagaaagctactccaaattagtagtagctacattaaactgtgcagctgaaatttcctcctccacagtaacaatttcatgttgatcaata |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32135776 |
aaccggagaatcagaaagctgctccaaattagtagtagctacattaaactgtgcagctgaaatttcctcctccacagtaacaatttcctgttgatcaata |
32135875 |
T |
|
| Q |
101 |
gagatattatcaatcagatttgcacgttctgattcttggtccttttctgttgggaatgaagcatcatgaggaacggggacctgaaccggctgctgctgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32135876 |
gagatattatcaatcagatttgcacgttctgattcttgatccttttccgttgggaatgaagcgtcatgaggaacggggacctgaactggctgctgctgtg |
32135975 |
T |
|
| Q |
201 |
aagtacgctgctgatccgcaagatgcagggtccctgctgtagtaactggcacaacatcctgaggttgcgcaaaagcaagtgaagacccaatgccagaagg |
300 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32135976 |
aaggacgctgctgatccgcaagatgcagggtccctgctgtagtaactggcacaacatcctgaggttgcgcaaaagcaagtgaagacccaatgccagaagg |
32136075 |
T |
|
| Q |
301 |
gttgtcaataggcttccaggtttgcttcggaatgggaacctgtttctttccatgtgcaactgacaatttatgcgcagcagtgtcttgacggggatat |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
32136076 |
gttgtcaataggcttccaggtttgcttcggaatgggaacctgtttctttccctgtgcaactgacaatttatgcgcagcagcgtcttgacgaggatat |
32136172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University