View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5416_low_6 (Length: 226)
Name: NF5416_low_6
Description: NF5416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5416_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 10155248 - 10155052
Alignment:
| Q |
12 |
atcatcacaactacagcaagccgcacttagtccttttcaaagtaacgaatgaatgcctttatcttaactgcatcaaccattaaactaaaatacgtatgtc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10155248 |
atcatcacaactacagcaagccgcacttggtccttttcaaagtaacgaatgaatgcctttatcttaactgcatcaaccattaaactaaaatacgtatgtc |
10155149 |
T |
 |
| Q |
112 |
taccactnnnnnnntgatgagaataatgtcataaaacaaagcaaattgtgagtctataagcatgtttccactcaaatcaagagtcaaatagggatac |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10155148 |
taccactaaaaaaatgatgagaataatgtcataaaacaaagcaaattctgagtctataagcatgtttccactcaaatcaaaagtcaaatagggatac |
10155052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University