View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5417_high_7 (Length: 399)
Name: NF5417_high_7
Description: NF5417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5417_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 44198582 - 44198480
Alignment:
| Q |
1 |
acacttaattgtaagtgtcactggataggggggtgttcgtggctcataattgaattgtaactgcatcgtattaaccgtttggttcagtttttaaaaatca |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44198582 |
acacttaattgtaagtgtcactagatagaggggtgttcgtggctcataattgaactgtaactgcatcgtattaaccgtttggttcagtttttaaaaacca |
44198483 |
T |
|
| Q |
101 |
ttt |
103 |
Q |
| |
|
||| |
|
|
| T |
44198482 |
ttt |
44198480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University