View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5417_low_19 (Length: 240)
Name: NF5417_low_19
Description: NF5417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5417_low_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 19755097 - 19755319
Alignment:
| Q |
18 |
agtaggagattttgtctttggagaatcttgtttagattcatctttagattctttgacatattctttacgaccttccccatcagtgtcagtgtgctttgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755097 |
agtaggagattttgtctttggagaatcttgtttagattcatctttagattctttgacatattctttacgaccttccccatcagtgtcagtgtgctttgta |
19755196 |
T |
 |
| Q |
118 |
tcatcttcagagttcaacccacgaggttctttactttttccaccttcgaccggagatggacccccttcattttcttcataaatgtgttgttgatcatctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19755197 |
tcatcttcagagttcaacccacgaggttctttactttttccactttcgaccagagatggacccccttcattttcttcatcaatgtgttgttgatcatctt |
19755296 |
T |
 |
| Q |
218 |
caacacttttagcattcaaatct |
240 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
19755297 |
caacacttttatcattcaaatct |
19755319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University