View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418-Insertion-18 (Length: 125)
Name: NF5418-Insertion-18
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418-Insertion-18 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 2e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 44624485 - 44624605
Alignment:
| Q |
8 |
ttcacaacaacacagtgcaacgtttcttcaaatcaattcatgatgatnnnnnnnnnntat---gatcaaaattgagtgtgtaaagagtgttaccctccga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44624485 |
ttcacaacaacacagtgcaacgtttcttcaaatcaattcatgatgaataaaaaaaaaaataatgatcaaaattgagtgtgtaaagagtgttaccctccga |
44624584 |
T |
 |
| Q |
105 |
gacccatggagatggcgccgg |
125 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44624585 |
gacccatggagatggcgccgg |
44624605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 123
Target Start/End: Original strand, 44635824 - 44635852
Alignment:
| Q |
95 |
taccctccgagacccatggagatggcgcc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44635824 |
taccctccgagacccatggagatggcgcc |
44635852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University