View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5418-Insertion-18 (Length: 125)

Name: NF5418-Insertion-18
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5418-Insertion-18
NF5418-Insertion-18
[»] chr8 (2 HSPs)
chr8 (8-125)||(44624485-44624605)
chr8 (95-123)||(44635824-44635852)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 2e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 44624485 - 44624605
Alignment:
8 ttcacaacaacacagtgcaacgtttcttcaaatcaattcatgatgatnnnnnnnnnntat---gatcaaaattgagtgtgtaaagagtgttaccctccga 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||            ||   |||||||||||||||||||||||||||||||||||||    
44624485 ttcacaacaacacagtgcaacgtttcttcaaatcaattcatgatgaataaaaaaaaaaataatgatcaaaattgagtgtgtaaagagtgttaccctccga 44624584  T
105 gacccatggagatggcgccgg 125  Q
    |||||||||||||||||||||    
44624585 gacccatggagatggcgccgg 44624605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 95 - 123
Target Start/End: Original strand, 44635824 - 44635852
Alignment:
95 taccctccgagacccatggagatggcgcc 123  Q
    |||||||||||||||||||||||||||||    
44635824 taccctccgagacccatggagatggcgcc 44635852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University