View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_high_102 (Length: 241)
Name: NF5418_high_102
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_high_102 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 36834472 - 36834670
Alignment:
| Q |
1 |
cttctgttattaacaaccttctacctcgttctaatgaaaagtgcaacgatttataccttcaaatgcacagctgatcatggaggtggatgaataaagaaga |
100 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36834472 |
cttctgttactaacaatcttctacctcgtgctaatgaaaagtgcaacgatttataccttcaaatgcacagctgatcatggaggtggataaataaagaaga |
36834571 |
T |
 |
| Q |
101 |
tgaagtgatgaatcaaccaactctgcctgcaaattttgattttatcattaaaattttaaacccggtccggttcactaaaccggccgagttaccgatttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36834572 |
tgaagtgatgaatcaaccaactctgcctgcaaattttgattttatcattaaaattttaaacccggtccggttcactaaaccggccgagttaccggtttt |
36834670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 44055834 - 44055644
Alignment:
| Q |
1 |
cttctgttattaacaaccttctacctcgttctaatgaaaagtgcaacgatttataccttcaaatgcacagctgatcatggaggtggatgaataaagaaga |
100 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44055834 |
cttctgttactaacaatcttctacctcgtgctaatgaaaagtgcaacgatttataccttcaaatgcacagctgatcatggaggtggataaataaagaaga |
44055735 |
T |
 |
| Q |
101 |
tgaagtgatgaatcaaccaactctgcctgcaaattttgattttatcattaaaattttaaacccggtccggttcactaaaccggccgagtta |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44055734 |
tgaagtgatgaatcaaccacctctgcctgcaaattttgattttatcattaaaattttaaacccggtccggttcactaaaccggccgagtta |
44055644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 199
Target Start/End: Complemental strand, 40484868 - 40484829
Alignment:
| Q |
160 |
acccggtccggttcactaaaccggccgagttaccgatttt |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
40484868 |
acccggtccggttcaccaaaccggccgagtcaccgatttt |
40484829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 42346240 - 42346297
Alignment:
| Q |
160 |
acccggtccggttcactaaaccggccgagttaccgatttttcccgagttataccggtt |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| ||||| ||||| ||||||||| |
|
|
| T |
42346240 |
acccggtccggttcaccaaaccggccgagtcaccggtttttagcgagtcataccggtt |
42346297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 199
Target Start/End: Complemental strand, 36099003 - 36098964
Alignment:
| Q |
160 |
acccggtccggttcactaaaccggccgagttaccgatttt |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
36099003 |
acccggtccggttcaccaaaccggccgagtcaccgatttt |
36098964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 160 - 199
Target Start/End: Original strand, 28235588 - 28235627
Alignment:
| Q |
160 |
acccggtccggttcactaaaccggccgagttaccgatttt |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
28235588 |
acccggtccggttcaccaaaccggccgagtcaccgatttt |
28235627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 208
Target Start/End: Complemental strand, 281144 - 281096
Alignment:
| Q |
160 |
acccggtccggttcactaaaccggccgagttaccgatttttcccgagtt |
208 |
Q |
| |
|
||||| |||||||| ||||||||||||||| |||||||| | ||||||| |
|
|
| T |
281144 |
acccgctccggttcgctaaaccggccgagtcaccgatttattccgagtt |
281096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University