View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_high_107 (Length: 238)
Name: NF5418_high_107
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_high_107 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 233
Target Start/End: Original strand, 29385826 - 29386050
Alignment:
| Q |
9 |
atcaattatgtcttttttctctttccatttccaccgtcccctaattttccaatcacataaaccgactagaataatttcttactcgagtaaattttcaaaa |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29385826 |
atcaattatgttttttttctctttccatttccaccgtcccctaattttccaatcacataaaccgactagaataatttcttactcgagtaaattttcaaaa |
29385925 |
T |
|
| Q |
109 |
tacatgcatgtcactttataacttttttagtcaaacaaaggtctaatcgatctttattcattttcctcctatttagactattatgtacgagtgcattata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29385926 |
tacatgcatgtcactttataacttttttagtcaaacaaaggtctaatcgatctttattcattttcctcctatttagactattatgtacgagtgcattata |
29386025 |
T |
|
| Q |
209 |
tttttctacttagacttctcctatg |
233 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
29386026 |
tttttctacttagacttcttctatg |
29386050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University