View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_high_115 (Length: 211)
Name: NF5418_high_115
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_high_115 |
 | |
|
| [»] scaffold0227 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 54 - 194
Target Start/End: Original strand, 10862420 - 10862560
Alignment:
| Q |
54 |
cttttgttcgacgaggacttttttagtaggtttgaggatcttgatgaccctggccctgagatttctagaattatcactgaagttcttttccttcacaatg |
153 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10862420 |
cttttattcgacaaggacttttttagaaggtttgaggatcatgatggccctggcccttagatttctagaattatcactgaagttcttttccttcacaatg |
10862519 |
T |
|
| Q |
154 |
ggccgatatatggttttgctcttgacatccctatccctatg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10862520 |
ggccgatatatggttttgctcttgacatccctatccctatg |
10862560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 115 - 164
Target Start/End: Complemental strand, 40011093 - 40011044
Alignment:
| Q |
115 |
tttctagaattatcactgaagttcttttccttcacaatgggccgatatat |
164 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
40011093 |
tttcaagaattatcacggaagttcttttcctccacaatggaccgatatat |
40011044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 66 - 185
Target Start/End: Complemental strand, 3586 - 3467
Alignment:
| Q |
66 |
gaggacttttttagtaggtttgaggatcttgatgaccctggccctgagatttctagaattatcactgaagttcttttccttcacaatgggccgatatatg |
165 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||| || |||||||||||||||||| |
|
|
| T |
3586 |
gaggacttcttttgtaggttcgaggatcttaatgaccctggccctgagatttctagaattatcaccgaaattcttttactccacaatgggccgatatata |
3487 |
T |
|
| Q |
166 |
gttttgctcttgacatccct |
185 |
Q |
| |
|
| ||| |||||| |||||| |
|
|
| T |
3486 |
gatttattcttgatatccct |
3467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 106 - 161
Target Start/End: Original strand, 16865530 - 16865585
Alignment:
| Q |
106 |
gccctgagatttctagaattatcactgaagttcttttccttcacaatgggccgata |
161 |
Q |
| |
|
|||||||| ||| || ||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
16865530 |
gccctgaggtttgtataattatcacggaagttcttttgctccacaatgggccgata |
16865585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University