View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_high_47 (Length: 366)
Name: NF5418_high_47
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 158 - 214
Target Start/End: Complemental strand, 31587379 - 31587323
Alignment:
| Q |
158 |
ttgaacggaggtatggggacgataaaaaatttccttaacttgtccaagcaccatata |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31587379 |
ttgaacggaggtatggggacgataaaaaatttccttaacttgtccaagcaccatata |
31587323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 27 - 75
Target Start/End: Complemental strand, 31588060 - 31588011
Alignment:
| Q |
27 |
ttatttttgggccataggca-taaatgggggtatgaagtgaaattccctt |
75 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31588060 |
ttatttttgggccataggcaataaatgggggtatgaagtgaaattccctt |
31588011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 93 - 130
Target Start/End: Complemental strand, 31588025 - 31587988
Alignment:
| Q |
93 |
aagtgaaattcccttgttgttgagctataagggaaaga |
130 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31588025 |
aagtgaaattcccttcttgttgagctataagggaaaga |
31587988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 307 - 353
Target Start/End: Complemental strand, 41930235 - 41930189
Alignment:
| Q |
307 |
gtcaagtagtttagtggctactggctagagctcgcacaatttaattg |
353 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
41930235 |
gtcaagcagtctagtggctagtggctagagctcacacaatttaattg |
41930189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University