View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5418_high_47 (Length: 366)

Name: NF5418_high_47
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5418_high_47
NF5418_high_47
[»] chr3 (3 HSPs)
chr3 (158-214)||(31587323-31587379)
chr3 (27-75)||(31588011-31588060)
chr3 (93-130)||(31587988-31588025)
[»] chr5 (1 HSPs)
chr5 (307-353)||(41930189-41930235)


Alignment Details
Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 158 - 214
Target Start/End: Complemental strand, 31587379 - 31587323
Alignment:
158 ttgaacggaggtatggggacgataaaaaatttccttaacttgtccaagcaccatata 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31587379 ttgaacggaggtatggggacgataaaaaatttccttaacttgtccaagcaccatata 31587323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 27 - 75
Target Start/End: Complemental strand, 31588060 - 31588011
Alignment:
27 ttatttttgggccataggca-taaatgggggtatgaagtgaaattccctt 75  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||    
31588060 ttatttttgggccataggcaataaatgggggtatgaagtgaaattccctt 31588011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 93 - 130
Target Start/End: Complemental strand, 31588025 - 31587988
Alignment:
93 aagtgaaattcccttgttgttgagctataagggaaaga 130  Q
    ||||||||||||||| ||||||||||||||||||||||    
31588025 aagtgaaattcccttcttgttgagctataagggaaaga 31587988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 307 - 353
Target Start/End: Complemental strand, 41930235 - 41930189
Alignment:
307 gtcaagtagtttagtggctactggctagagctcgcacaatttaattg 353  Q
    |||||| ||| ||||||||| |||||||||||| |||||||||||||    
41930235 gtcaagcagtctagtggctagtggctagagctcacacaatttaattg 41930189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University