View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_high_60 (Length: 335)
Name: NF5418_high_60
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_high_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 18 - 322
Target Start/End: Original strand, 40122059 - 40122363
Alignment:
| Q |
18 |
gtagcgatttccattgaaatttgaaaagaagcaatgaacatagacgataacgtggcttctttaaccccaaaattcccggtttcccaactcaatttctcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40122059 |
gtagcgatttccattgaaatttgaaaagaagcaatgaacatagacgataacgtggcttctttaaccccaaaattcccagtttcccaactcaatttctcta |
40122158 |
T |
|
| Q |
118 |
ttgaaatcaaggtatgtgcgcctctcactcttttcttcttcattgtttggatttggattaggattaggttaatattgatattcaaaactattatcattca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40122159 |
ttgaaatcaaggtatgtgcgcctctcactcttttcttcttcatagtttggatttggattaggattaggttaatattgatattcaaaactattatcattca |
40122258 |
T |
|
| Q |
218 |
tcttggttaatttgctttacttctcagggaaacaaaactgaaatcatcattacaagttacgaagatcattttatggtgagtgttattggatatgtacatg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40122259 |
tcttggttaatttgctttacttctcagggaaacaaaactgaaatcatcatttcaagttacgaagatcattttatggtgagtgttattggatatgtacatg |
40122358 |
T |
|
| Q |
318 |
catct |
322 |
Q |
| |
|
||||| |
|
|
| T |
40122359 |
catct |
40122363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University