View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5418_high_84 (Length: 259)
Name: NF5418_high_84
Description: NF5418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5418_high_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 31646603 - 31646841
Alignment:
| Q |
4 |
aaagttaatcgggaattaacttagaaccaaataatatatagtttatgataaaaggtattttagcctatgtttataaataaaaaacactatatagtacacn |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31646603 |
aaagttaatcgggaattaacttagaaccaaataatatatagtttatgacaaaaggtattttagcctatgtttataaataaaaaacactatatagtacact |
31646702 |
T |
 |
| Q |
104 |
nnnnnnacatgat-attacattatttattattgatgtatttattacaaatttgaaataccagtcaaatgacaattcttttacattatactagattgattt |
202 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
31646703 |
ttttt-acatgattaatacattatttattattgatgtatttattacaaatttgaaataccagtcaaatgacaattattttacattatactaaattgattt |
31646801 |
T |
 |
| Q |
203 |
tttgtcttttgctaaattaaggtaatctttccacgaaact |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31646802 |
tttgtcttttgctaaattaaggtaatctttccacgaaact |
31646841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University